Print this page. Print this page.

Measurement of EHEC O157:H7 and EHEC O26

Series: Ernestly measurement

Measurement of EHEC O157:H7 and EHEC O26

Carried out in cooperation with Zensho Holdings Co., Ltd. and Nippon Genetics Co., Ltd.

Enterohemorrhagic E. coli (EHEC) represented by EHEC O157:H7 is E. coil that produces verotoxin (VT).
This type of bacteria is resistant to dryness, low temperatures, and freezing environment and EHEC O157:H7 is also resistant to acids. It is highly infectious and even a small amount can develop symptoms, which makes it threatening.
We tested if the gene that produces verotoxin can be measured using a mobile PCR device.

Sample

Sample A: EHEC O157 obtained from the surface of beef was placed in mEC culture medium to give a concentration of approx. 10 cfu/L.
Sample B: EHEC O26 obtained by the same procedure was placed in EC culture medium to give a concentration of approx. 10cfu/L, and contaminating bacteria was added (approx. 3000 cfu/L).

Pre-culture

The samples were cultured at 42 degrees Celsius for 4 hours (1), 8 hours (2), and 11 hours (4). Furthermore, the solution cultured for 8 hours (3) was diluted tenfold.
*(3) is equivalent to a 7-hour culture.

Pretreatment

Heat treatment at 98 degrees Celsius for 8 minutes after culture

Reaction composition

Enzyme: KAPA 3G Plant (Kapa Biosystems)
Primer and probe: Equivalent to specifications in Notification No. 1120-3 issued by the Food Inspection and Safety Division
Other compositions were determined by Nippon Genetics Co., Ltd.

Program

Detection time was approx. 25 min. (by Nippon Genetics Co., Ltd.)

Results

After 8-hour pre-culture, 10 cfu/L of enterohemorrhagic EHEC was measured with pretreatment using only heat treatment. It is assumed that measurement is possible with a 7-hour pre-culture which indicates that determination can be provided within 8 hours including the time required for measurement (within working hours).

Measurement was carried out by a multi-mix of VT1 and VT2.

VT1-Primer F    5’-GGA TAA TTT GTT TGC AGT TGA TGTC-3’ (25mer)
VT1-Primer R    5’-CAA ATC CTG TCA CAT ATA AAT TAT TTC GT-3’ (29mer)
VT1-probe       5’FAM-CCG TAG ATT ATT AAA CCG CCC TTC CTC TGG A-3’BHQ1 (31mer)
VT2-Primer F    5’- GGGCAGTTATTTTGCTGTGGA -3’ (21mer)
VT2-Primer R    5’-GAAAGTATTTGTTGCCGTATTAACGA-3’ (26mer)
VT2-probe         5’FAM-ATGTCTATCAGGCGCGTTTTGACCATCTT-BHQ2’ (29mer)